Home
[Go Back] 
Fixed 5' end of primers:

You can specify the position(s) of both the primers, using the instructions below.

Note: You can also specify the position of only the forward or reverse primer(s) along with the product length (the other primer will be located based on the product length). Use the drop-down options on the below to choose this approach.

Instructions: (When you need to specify position of both primers)
1. Mark the 5' end position of the expected forward primer in the source sequence using '()' and similarly mark the other end, which will be complementary to the 5' end position of the reverse primer, using '[]' {see example}

2.Click on "Confirm Position" button and then on the "Generate Primers" button on the bottom.

Example :
TTCCCGGCAATGATGTCGATGACCAGTTGA()AGAGGATCTTCCGACTGCTGGGGACGCCCACCGAGGAGCAGTGGCCCTCTATGACCAAGCTGCCAGACTATAAGCCCTATCCGATGTACCCGGCCACAACATCCCTGGTGAACGTCGTGCCCAAACTCAATGCCACAGGGAGGGATCTGCTGCAGAACCTTCTGAAGTGTAACCCTGTCCAGCGTATCTCAGCAGAAGAGGCCCTGCAGCACCCCTACTTCTCCGACTTCTGTCCGCCCTAGGCCCCGGGACCCCCGGCCTCCAGGCTGGGGCCTGGCCTATTTAAGCCCCCTCTTGAGAGGGGTGAGACAGTGGGGGTGCCTGGTGCGCTGTGCTCCAGCAGTGCTGGGCCCAGCCGGGGTGGGGTGCCTGAGCCCGAATTTCTCACTCCCTTTGT[]GGACTTTATTTAATTTCATAAATTGGCTCCTTTCCCACA
Primer Type  
Paste the Sequence: (example)


Junction 2
Base at 5' end of junction (pre-junction serial no.):
Base at 3' end of junction (post-junction serial no.):
Advanced options
Primer Length: Plus or Minus
PCR Product Length (bp):
GC%:
Tm:
Tm calculation:
Send results through email